Mitochondrial DNA is helpful in obtaining a DNA profile for very degraded genetic material because
A) cells have many mitochondria, and therefore several copies of mtDNA sequences.
B) the mitochondrial outer membrane protects it from being damaged.
C) mitochondria contain oxidative enzymes that protect the DNA.
D) mtDNA consists of a single helix, so it cannot be unwound.
E) it uses uracil instead of thymine, which is a more stable nitrogenous base.
Correct Answer:
Verified
Q21: An RFLP is a
A) DNA probe used
Q22: Which of the following have the longest
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A) VNTR.
B)
Q24: A series of markers have the following
Q25: DNA profiling was less useful in identifying
Q27: A "cold hit" refers to
A) a DNA
Q28: In order to identify (or rule out
Q29: VNTRs and STRs differ in that
A) a
Q30: A suspect's guilt seems highly likely when
Q31: Who invented DNA profiling?
A) Godfrey Hardy
B) William
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents