A "cold hit" refers to
A) a DNA profile made from frozen DNA, such as from a wooly mammoth.
B) identifying a suspect from DNA alone.
C) a technology to preserve DNA.
D) using CODIS to identify the victim of a crime.
E) using mitochondrial DNA to take a DNA profile.
Correct Answer:
Verified
Q22: Which of the following have the longest
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A) VNTR.
B)
Q24: A series of markers have the following
Q25: DNA profiling was less useful in identifying
Q26: Mitochondrial DNA is helpful in obtaining a
Q28: In order to identify (or rule out
Q29: VNTRs and STRs differ in that
A) a
Q30: A suspect's guilt seems highly likely when
Q31: Who invented DNA profiling?
A) Godfrey Hardy
B) William
Q32: Frequency of an X-linked recessive allele in
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents