DNA profiling was less useful in identifying remains from the 2004 tsunami than in criminal cases because
A) the DNA after the tsunami was too wet to analyze.
B) rescuers could not get to the scene of the tsunami in time to collect DNA.
C) the tsunami left few bodies with collectible DNA.
D) not enough repeats were profiled.
E) none of the victims were listed in the FBI's files.
Correct Answer:
Verified
Q20: If the incidence of Tay-Sachs is 1/3,600
Q21: An RFLP is a
A) DNA probe used
Q22: Which of the following have the longest
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A) VNTR.
B)
Q24: A series of markers have the following
Q26: Mitochondrial DNA is helpful in obtaining a
Q27: A "cold hit" refers to
A) a DNA
Q28: In order to identify (or rule out
Q29: VNTRs and STRs differ in that
A) a
Q30: A suspect's guilt seems highly likely when
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents