If the incidence of Tay-Sachs is 1/3,600 Ashkenazim births,what is the heterozygote (carrier) frequency?
A) 0.0003
B) 0.029
C) 0.286
D) 0.684
E) near 1.0
Correct Answer:
Verified
Q15: For a very rare inherited disease,the frequency
Q16: If one person in 50 is a
Q17: In a population in Hardy-Weinberg equilibrium,frequency of
Q18: Hardy-Weinberg equilibrium is possible only if the
Q19: Hardy-Weinberg calculations are based on
A) the binomial
Q21: An RFLP is a
A) DNA probe used
Q22: Which of the following have the longest
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A) VNTR.
B)
Q24: A series of markers have the following
Q25: DNA profiling was less useful in identifying
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents