Question 1

Below are four overlapping reads from sequencing.(Note: All reads are in the 5′-to-3′ direction.)
Read 1: TTACACGCCATCGACTGGATCATATATGC
Read 2: CATATATGCATGCAGCGCATGACCCCTAG
Read 3: AGTCTGCAAATGCTGCGATTACACGCCA
Read 4: CCCCTAGAGCTGGGGATCAGAGTCGATT
In the correct order, read 3 is the first sequence, followed by read _______.

Accepted Answer

The answer of Below are four overlapping reads from sequencing.(Note:...

Question 2

Succinate is a chemical involved in the Krebs cycle in the generation of energy.It is thus a(n)

Accepted Answer

Succinate is a chemical involved in the Krebs cycle, which is a crucial step in the generation of energy in living organisms. Therefore, it is a primary metabolite, which refers to the molecules that are directly involved in the normal growth, development, and reproduction of an organism. Secondary metabolites, on the other hand, are molecules that are not directly involved in these processes but may have other functions such as defense or communication. Haplotype refers to the specific combination of alleles that an individual inherits at a given locus, while proteome refers to the complete set of proteins expressed by an organism or a cell. Enzyme is a protein molecule that catalyzes a specific biochemical reaction.

Question 3

What evidence suggests that Neanderthals may have had red hair?

Accepted Answer

The evidence suggesting Neanderthals may have had red hair comes from the discovery of a variant of the MC1R gene in Neanderthals that is associated with red hair and pale skin in modern humans. This variant appears to be less actively expressed, which is consistent with the characteristics of red hair and pale skin.

Question 4

Which statement best reflects genetic determinism?

Accepted Answer

Genetic determinism is the belief that an individual's genetic makeup fully determines their traits and behaviors. Choice B reflects this idea by suggesting that mutations in the FOXP2 gene lead to difficulty processing language, implying a direct causal relationship between genetics and behavior.

Question 5

A group of biologists is studying the link between genetic variation and variation in response to statin drugs in a group of people with heart disease.This activity is best described as

Accepted Answer

This activity involves studying the relationship between genetic variation and response to drugs, which falls under the scope of pharmacogenomics.

Question 6

A researcher finds that individuals with a particular genotype metabolize a drug faster than average, and she uses this information to provide genotype-specific guidelines for dosages of the drug.This is an example of

Accepted Answer

The answer of A researcher finds that individuals with a...

Question 7

Which type of gene would you expect to be found in the widest (most encompassing) group of organisms?

Accepted Answer

Glucose metabolism is a basic process that is essential for energy production in all living organisms, from bacteria to humans. Therefore, a gene involved in glucose metabolism is likely to be found in the widest group of organisms. Genes involved in immune systems, communication between cells, the central nervous system, and complex development are more specialized and may not be present in all organisms.

Question 8

High-performance liquid chromatography is most closely associated with

Accepted Answer

The answer of High-performance liquid chromatography is most closely associated...

Question 9

A drug that reduces blood pressure is broken down by an enzyme and becomes inactive.Individuals who have a more active enzyme will tend to have _______ blood pressure than those with the less active version of the enzyme and will thus need to take the drug _______ often.

Accepted Answer

Individuals with a more active enzyme will break down the drug more quickly, resulting in lower levels of the drug in their system, which means that their blood pressure will be higher. Therefore, they will need to take the drug more often to maintain a lower blood pressure.

Question 10

A hormone is produced to regulate water balance.It would be considered a(n)

Accepted Answer

Primary metabolites are substances produced during the growth of new cells and are necessary for the basic functions of the organism, such as growth and development. Hormones that regulate water balance, such as antidiuretic hormone (ADH), are essential for the organism's survival, making them primary metabolites.

Question 11

Gas chromatography is most often used in

Accepted Answer

Gas chromatography is a technique commonly used in metabolomics, which is the study of metabolites (small molecules) produced by an organism or system. Gas chromatography is used to separate and identify the different metabolites in a sample. It is not typically used in proteomics, haplotype mapping, metagenomics, or functional genomics.

Question 12

An attack by a leaf-eating insect is most likely to change the _______ of a plant and is least likely to change the _______.

Accepted Answer

An attack by a leaf-eating insect is most likely to change the secondary metabolites of a plant, as these compounds often play a role in defense against herbivores. It is least likely to change the DNA sequence, as insect attacks do not typically alter the genetic code of the plant.

Question 13

Gorillas differ from humans at about 2 percent of the genome, considering just single nucleotide changes.Thus, in a haploid genome, how many SNPs are there between humans and gorillas?

Accepted Answer

The answer of Gorillas differ from humans at about 2...

Question 14

A group of biologists is examining changes in the proteins in monkeys as they change in social status.This activity is best characterized as

Accepted Answer

Proteomics is the study of the protein makeup and changes in organisms, tissues, or cells. Examining changes in proteins in monkeys as they change social status falls under the category of proteomics. The biologists are specifically studying variations in the monkeys' protein expression that may correlate with their social status.

Question 15

An enzyme is required to convert the inactive form of a drug into the active form.A completely dominant change from the G to the C allele increases activity of the enzyme.Too much of the active form of the drug can lead to tremors.Too little of the active form of the drug renders it ineffective.Which scenario is most likely?

Accepted Answer

The GC genotype results in increased activity of the enzyme, which can lead to too much of the active form of the drug, causing tremors. Therefore, individuals with the GC genotype are more likely to have tremors from the drug than those with GG. Option A is incorrect because CC genotype is expected to have even higher activity of the enzyme than GC, which would lead to even more tremors. Option C is incorrect because individuals with the GC genotype have more active enzyme and would therefore have more active drug, making it less likely to be ineffective. Option D is incorrect because CC genotype would have even higher enzyme activity than GC, which would make the drug more effective. Option E is incorrect because individuals with the GG genotype would have lower enzyme activity, which would result in less active drug and potentially render it ineffective.

Question 16

Bacteria use colicins to kill other bacteria.Colicins are best described as

Accepted Answer

Colicins are secondary metabolites produced by certain bacteria as a defense mechanism against other bacteria. They are not essential for bacterial growth and reproduction, but rather have a specific function in killing competing bacteria.

Question 17

For the DNA sequence that begins 5′-GTCATAG…, the complement is _______.(Label the polarity accordingly.)

Accepted Answer

The answer of For the DNA sequence that begins 5′-GTCATAG…,...

Question 18

Suppose, in contrast to the actual situation, that Neanderthals had a variant of the FOXP2 gene that resembled the chimpanzee variant more than the human variant.What would be the most reasonable inference based on this counterfactual finding?

Accepted Answer

FOXP2 is a gene that is important for language and speech in humans. If Neanderthals had a variant of the FOXP2 gene that was more similar to the chimpanzee variant, then it is likely that they lacked the capacity for complex speech and language. This is because the human variant of the FOXP2 gene has been shown to be involved in the development and function of neural circuits that are necessary for speech and language. Therefore, if Neanderthals had a gene that was less efficient in this regard, it suggests that they did not have as advanced a capacity for speech and language as humans do.

Question 19

Positions 4376, 5674, 6745, and 6799 along a gene are polymorphic.Alleles at these sites are usually inherited together as a block, instead of being independent.This block is an example of a(n)

Accepted Answer

A haplotype is a group of alleles that are inherited together on the same chromosome. In this case, the alleles at positions 4376, 5674, 6745, and 6799 are usually inherited together as a block, making it a haplotype rather than individual SNPs.

SNPs (A) are single nucleotide polymorphisms, which are variations in a single base pair of DNA.

LINE (C) and SINE (D) are types of transposable elements in the genome.

Pseudogenes (E) are non-functional copies of genes that have accumulated mutations over time.

Question 20

Biologists are examining changes in the proteins expressed by a nematode species under different levels of crowding.Which is the most likely tool or approach that they would use?

Accepted Answer

Mass spectrometry is commonly used for protein analysis, so it is the most likely choice for examining changes in protein expression in this scenario. Metabolomics (A) would be used to study changes in metabolites, haplotype mapping (B) would be used to study genetic variation, gas chromatography (D) would be used to separate and identify chemical compounds in a sample, and metagenomics (E) would be used to analyze the collective genetic material of a community of organisms.

Quiz 17: Genomes