The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
A) two
B) three
C) four
D) five

Question

Quizplus · Accepted Answer

The recognition sequence for SacI is GAGCT^C. In the given DNA molecule, this sequence appears three times, indicating that SacI would cut the DNA at three places. Each cut would divide the DNA into two parts, so starting with one molecule and making three cuts would result in four separate molecules of DNA.

The Restriction Enzyme SacI Has a Recognition Sequence of GAGCT^C