In a population in Hardy-Weinberg equilibrium,frequency of a dominant allele is
A) p.
B) p2.
C) 2pq.
D) q.
Correct Answer:
Verified
Q13: In a population in Hardy-Weinberg equilibrium,the frequency
Q14: Which of the following would not alter
Q15: Hardy-Weinberg equilibrium is possible only if the
Q16: Tay-Sachs disease affects in 1 in 3,600
Q17: Which group is used to calculate the
Q19: In a population in Hardy-Weinberg equilibrium,75 percent
Q20: The difference between microevolution and macroevolution is
Q21: VNTRs and STRs differ in that
A)a VNTR
Q22: A suspect's guilt seems highly likely when
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents