The difference between microevolution and macroevolution is that
A) microevolution affects bacteria and macroevolution affects larger organisms.
B) microevolution happens slowly and macroevolution happens quickly.
C) macroevolution happens slowly and microevolution happens quickly.
D) microevolutionary changes are small,and macroevolutionary changes are large.
Correct Answer:
Verified
Q15: Hardy-Weinberg equilibrium is possible only if the
Q16: Tay-Sachs disease affects in 1 in 3,600
Q17: Which group is used to calculate the
Q18: In a population in Hardy-Weinberg equilibrium,frequency of
Q19: In a population in Hardy-Weinberg equilibrium,75 percent
Q21: VNTRs and STRs differ in that
A)a VNTR
Q22: A suspect's guilt seems highly likely when
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q24: Principles of population genetics must be applied
Q25: Researchers began using short tandem repeats (STRs)because
A)shorter
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents