VNTRs and STRs differ in that
A) a VNTR repeat is shorter than an STR repeat.
B) a VNTR repeat is longer than an STR repeat.
C) a VNTR is a type of copy number variant and an STR is not.
D) an STR is a type of copy number variant and a VNTR is not.
Correct Answer:
Verified
Q16: Tay-Sachs disease affects in 1 in 3,600
Q17: Which group is used to calculate the
Q18: In a population in Hardy-Weinberg equilibrium,frequency of
Q19: In a population in Hardy-Weinberg equilibrium,75 percent
Q20: The difference between microevolution and macroevolution is
Q22: A suspect's guilt seems highly likely when
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q24: Principles of population genetics must be applied
Q25: Researchers began using short tandem repeats (STRs)because
A)shorter
Q26: The parts of the genome that are
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents