A suspect's guilt seems highly likely when a very rare combination of markers is
A) found in the population the suspect comes from and at the crime scene.
B) not found in the population the suspect comes from,but present at the crime scene.
C) found in the suspect's DNA but not at the crime scene or in the population the suspect comes from.
D) found in the population the suspect comes from,in the suspect's DNA,and at the crime scene.
Correct Answer:
Verified
Q17: Which group is used to calculate the
Q18: In a population in Hardy-Weinberg equilibrium,frequency of
Q19: In a population in Hardy-Weinberg equilibrium,75 percent
Q20: The difference between microevolution and macroevolution is
Q21: VNTRs and STRs differ in that
A)a VNTR
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q24: Principles of population genetics must be applied
Q25: Researchers began using short tandem repeats (STRs)because
A)shorter
Q26: The parts of the genome that are
Q27: Combined DNA Index System (CODIS)is
A)a fifteen-base DNA
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents