Researchers began using short tandem repeats (STRs) because
A) shorter DNA molecules were more likely to persist in a violent situation.
B) each person has no more than one copy of each STR.
C) STRs are nonuniformly distributed.
D) restrictive enzymes cannot be used to cut short DNA molecules.
Correct Answer:
Verified
Q20: The difference between microevolution and macroevolution is
Q21: VNTRs and STRs differ in that
A)a VNTR
Q22: A suspect's guilt seems highly likely when
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q24: Principles of population genetics must be applied
Q26: The parts of the genome that are
Q27: Combined DNA Index System (CODIS)is
A)a fifteen-base DNA
Q28: In order to identify (or rule out
Q29: A common source of DNA for forensic
Q30: Familial DNA search was used in the
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents