In order to identify (or rule out identity) from a DNA sample that is a mixture,the investigator should know
A) how long the DNA has been exposed to the environment.
B) how the person perished.
C) the population groups to which the person of interest belongs or belonged.
D) the genome sequence of the suspect or missing person.
Correct Answer:
Verified
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q24: Principles of population genetics must be applied
Q25: Researchers began using short tandem repeats (STRs)because
A)shorter
Q26: The parts of the genome that are
Q27: Combined DNA Index System (CODIS)is
A)a fifteen-base DNA
Q29: A common source of DNA for forensic
Q30: Familial DNA search was used in the
Q31: Mitochondrial DNA (mtDNA)is helpful in obtaining a
Q32: DNA profiling was less useful in identifying
Q33: Who invented DNA profiling?
A)Godfrey Hardy
B)William Weinberg
C)Sir Alec
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents