Principles of population genetics must be applied to determine identity based on DNA profiling because
A) VNTRs are not found in all populations.
B) individuals are their own populations.
C) nonrandom mating does not occur in all populations.
D) alleles are invariant between all human populations.
Correct Answer:
Verified
Q19: In a population in Hardy-Weinberg equilibrium,75 percent
Q20: The difference between microevolution and macroevolution is
Q21: VNTRs and STRs differ in that
A)a VNTR
Q22: A suspect's guilt seems highly likely when
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q25: Researchers began using short tandem repeats (STRs)because
A)shorter
Q26: The parts of the genome that are
Q27: Combined DNA Index System (CODIS)is
A)a fifteen-base DNA
Q28: In order to identify (or rule out
Q29: A common source of DNA for forensic
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents