The parts of the genome that are used in markers of identity in DNA profiling
A) are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype.
B) are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype.
C) are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype.
D) are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype.
Correct Answer:
Verified
Q21: VNTRs and STRs differ in that
A)a VNTR
Q22: A suspect's guilt seems highly likely when
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A)VNTR.
B)STR.
C)RFLP.
D)SNP.
Q24: Principles of population genetics must be applied
Q25: Researchers began using short tandem repeats (STRs)because
A)shorter
Q27: Combined DNA Index System (CODIS)is
A)a fifteen-base DNA
Q28: In order to identify (or rule out
Q29: A common source of DNA for forensic
Q30: Familial DNA search was used in the
Q31: Mitochondrial DNA (mtDNA)is helpful in obtaining a
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents