In the eukaryotic DNA sequence below, which type of repeat is underlined? ATTATTTACTAATCCTCATCATCATCATCATGGAATTCATAATGCTAATGG
A) tandem repeat
B) dispersed repeat
C) simple sequence repeat
D) long terminal repeat
E) short terminal repeat
Correct Answer:
Verified
Q52: Whole genome sequencing is often approached by
Q53: According to the phylogenetic tree showing evolutionary
Q54: Consider a stretch of DNA with two
Q55: If you want to identify protein-coding sequences,
Q56: Which of the following represent repeated sequences
Q58: Sequences of genomic DNA, and its corresponding
Q59: In addition to noncoding sequences, most eukaryotic
Q60: Which one of the following BEST describes
Q61: A researcher annotating the rabbit genome would
Q62: Which one of following statements explains why
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents